Transcript: Mouse NM_027698.5

Mus musculus exoribonuclease 2 (Eri2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Eri2 (71151)
Length:
3569
CDS:
119..2185

Additional Resources:

NCBI RefSeq record:
NM_027698.5
NBCI Gene record:
Eri2 (71151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027698.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294650 ATTGATCTCAGAGCAACTTAC pLKO_005 656 CDS 100% 10.800 15.120 N Eri2 n/a
2 TRCN0000294632 CAACACTTAACTCCAACTTAG pLKO_005 1224 CDS 100% 10.800 15.120 N Eri2 n/a
3 TRCN0000099318 GCGGCTTATTGTTTCTAATAA pLKO.1 1921 CDS 100% 1.500 2.100 N Eri2 n/a
4 TRCN0000307384 CAACATGAAAGCAGATCTTTA pLKO_005 1057 CDS 100% 13.200 9.240 N Eri2 n/a
5 TRCN0000294651 TGCCTTCAGTGTATGTCTTAT pLKO_005 2204 3UTR 100% 13.200 9.240 N Eri2 n/a
6 TRCN0000099315 GCCTGGGTACAGATTTAGTTT pLKO.1 2757 3UTR 100% 5.625 3.938 N Eri2 n/a
7 TRCN0000099317 GCCTAGAGTATGAGTGTAGAA pLKO.1 597 CDS 100% 4.950 3.465 N Eri2 n/a
8 TRCN0000287145 GCCTAGAGTATGAGTGTAGAA pLKO_005 597 CDS 100% 4.950 3.465 N Eri2 n/a
9 TRCN0000099316 GCCTCCTGTTAGTGACACAAA pLKO.1 1390 CDS 100% 4.950 3.465 N Eri2 n/a
10 TRCN0000099319 CCTCCTGTATAAAGGGCCAAT pLKO.1 1023 CDS 100% 4.050 2.835 N Eri2 n/a
11 TRCN0000128769 CTTGGATTGATCTCAGAGCAA pLKO.1 651 CDS 100% 2.640 1.848 N ERI2 n/a
12 TRCN0000277657 CTTGGATTGATCTCAGAGCAA pLKO_005 651 CDS 100% 2.640 1.848 N ERI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027698.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.