Transcript: Mouse NM_027699.2

Mus musculus leucine rich repeat containing 72 (Lrrc72), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Lrrc72 (71156)
Length:
660
CDS:
149..469

Additional Resources:

NCBI RefSeq record:
NM_027699.2
NBCI Gene record:
Lrrc72 (71156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182195 CTGTTCGCTCACTCGTTAGAA pLKO.1 495 3UTR 100% 5.625 7.875 N Lrrc72 n/a
2 TRCN0000441640 GAACTGGAACACCGTTCTAAC pLKO_005 379 CDS 100% 10.800 7.560 N Lrrc72 n/a
3 TRCN0000197853 GTGATTCAATCAGTAGCATTT pLKO.1 182 CDS 100% 10.800 7.560 N Lrrc72 n/a
4 TRCN0000432894 GCCGCTGAGATGCTCATGATT pLKO_005 437 CDS 100% 5.625 3.938 N Lrrc72 n/a
5 TRCN0000198393 GTTGACAAGACACTGTTTGAT pLKO.1 296 CDS 100% 5.625 3.938 N Lrrc72 n/a
6 TRCN0000177627 CCAAGTTACCAATAAAGCAAA pLKO.1 231 CDS 100% 4.950 3.465 N Lrrc72 n/a
7 TRCN0000182337 GATGACGTTCACCAGCATGAA pLKO.1 361 CDS 100% 4.950 3.465 N Lrrc72 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.