Transcript: Mouse NM_027711.1

Mus musculus IQ motif containing GTPase activating protein 2 (Iqgap2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Iqgap2 (544963)
Length:
5771
CDS:
214..4941

Additional Resources:

NCBI RefSeq record:
NM_027711.1
NBCI Gene record:
Iqgap2 (544963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027711.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255006 CCGTCAGCAAGCCAGTTATTT pLKO_005 3818 CDS 100% 15.000 21.000 N Iqgap2 n/a
2 TRCN0000255005 TGATTGGAATCACGGCTTATA pLKO_005 5024 3UTR 100% 13.200 18.480 N Iqgap2 n/a
3 TRCN0000255007 TGTGGAGCAGACACGTTATAA pLKO_005 495 CDS 100% 15.000 12.000 N Iqgap2 n/a
4 TRCN0000255004 CTTGGGTTCCACCCGAATTAT pLKO_005 2075 CDS 100% 15.000 10.500 N Iqgap2 n/a
5 TRCN0000255003 TGGCCAAGCAGACCATTATAA pLKO_005 899 CDS 100% 15.000 10.500 N Iqgap2 n/a
6 TRCN0000047497 GCCTCCAACAAGCTGTTTGAA pLKO.1 3658 CDS 100% 5.625 3.938 N IQGAP2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5153 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027711.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.