Transcript: Mouse NM_027844.4

Mus musculus keratin associated protein 5-2 (Krtap5-2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Krtap5-2 (71623)
Length:
1474
CDS:
65..1168

Additional Resources:

NCBI RefSeq record:
NM_027844.4
NBCI Gene record:
Krtap5-2 (71623)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027844.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098361 GCAAGCCCTGTTGTTGCCAAT pLKO.1 1002 CDS 100% 4.050 2.430 N Krtap5-2 n/a
2 TRCN0000098362 GTTGTTGCCAATCCAGCTGTT pLKO.1 1011 CDS 100% 4.050 2.430 N Krtap5-2 n/a
3 TRCN0000098360 CCAAGAAGTACCTCTACTATT pLKO.1 1175 3UTR 100% 13.200 6.600 Y Krtap5-2 n/a
4 TRCN0000098364 TCCTGTATGCTGCCAGTGTAA pLKO.1 1141 CDS 100% 4.950 2.475 Y Krtap5-2 n/a
5 TRCN0000098463 GCTGCTGCAAGCCTGTGTGTT pLKO.1 141 CDS 100% 1.650 0.825 Y Krtap5-1 n/a
6 TRCN0000098464 GCTGCTGCAAGCCCTGCTGTT pLKO.1 1071 CDS 100% 0.000 0.000 Y Krtap5-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027844.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.