Transcript: Mouse NM_027922.2

Mus musculus ankyrin repeat and LEM domain containing 2 (Ankle2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Mus musculus (mouse)
Gene:
Ankle2 (71782)
Length:
5256
CDS:
234..3125

Additional Resources:

NCBI RefSeq record:
NM_027922.2
NBCI Gene record:
Ankle2 (71782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027922.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082060 GCTCGACTGAAACTCTTGAAT pLKO.1 447 CDS 100% 5.625 7.875 N Ankle2 n/a
2 TRCN0000433936 TGAAAGTGTAGCCGTAATAAT pLKO_005 3334 3UTR 100% 15.000 12.000 N Ankle2 n/a
3 TRCN0000433619 GATCCATGTTTACGAAGATAA pLKO_005 899 CDS 100% 13.200 10.560 N Ankle2 n/a
4 TRCN0000429965 GCTTACTCCTGGGATTCATTT pLKO_005 3131 3UTR 100% 13.200 10.560 N Ankle2 n/a
5 TRCN0000082058 CCACACACTATATTCAGCTAT pLKO.1 4785 3UTR 100% 4.950 3.960 N Ankle2 n/a
6 TRCN0000432284 GCTCTTGAGTGTGCGAATATT pLKO_005 2811 CDS 100% 15.000 10.500 N Ankle2 n/a
7 TRCN0000416976 TATGGAGTGTGTCCAGTATAT pLKO_005 852 CDS 100% 13.200 9.240 N Ankle2 n/a
8 TRCN0000082061 CCTGAAGAAGTAATTTGTGAA pLKO.1 1599 CDS 100% 4.950 3.465 N Ankle2 n/a
9 TRCN0000082059 CCTGGGTTGAATACTGGGAAT pLKO.1 1978 CDS 100% 4.050 2.835 N Ankle2 n/a
10 TRCN0000082062 CTGGGTTGAATACTGGGAATT pLKO.1 1979 CDS 100% 0.000 0.000 N Ankle2 n/a
11 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 3844 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027922.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.