Transcript: Mouse NM_027934.2

Mus musculus ring finger protein 180 (Rnf180), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rnf180 (71816)
Length:
3785
CDS:
200..1927

Additional Resources:

NCBI RefSeq record:
NM_027934.2
NBCI Gene record:
Rnf180 (71816)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235950 GATCACATGACCGTGAGTAAT pLKO_005 1418 CDS 100% 13.200 18.480 N Rnf180 n/a
2 TRCN0000235948 CCCACTGTGCCGGACAATTAT pLKO_005 1609 CDS 100% 15.000 10.500 N Rnf180 n/a
3 TRCN0000235949 GCTACAGAAGCAGGGTAAATA pLKO_005 1378 CDS 100% 15.000 10.500 N Rnf180 n/a
4 TRCN0000359009 GCTACAGAAGCAGGGTAAATA pLKO_005 1378 CDS 100% 15.000 10.500 N RNF180 n/a
5 TRCN0000235952 TAATGAGACCAGCGCTGAAAC pLKO_005 591 CDS 100% 10.800 7.560 N Rnf180 n/a
6 TRCN0000235951 GCCTACTACAGTGGTACTTTA pLKO_005 2317 3UTR 100% 13.200 7.920 N Rnf180 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.