Transcript: Mouse NM_027970.1

Mus musculus theg spermatid protein like (Thegl), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Thegl (71868)
Length:
1876
CDS:
130..1509

Additional Resources:

NCBI RefSeq record:
NM_027970.1
NBCI Gene record:
Thegl (71868)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190895 CCCGTGACCTTGTAAAGAAAT pLKO.1 629 CDS 100% 13.200 18.480 N Thegl n/a
2 TRCN0000217243 CTACGACCCAAACGTCTTTAA pLKO.1 1416 CDS 100% 13.200 18.480 N Thegl n/a
3 TRCN0000283839 TGATTCCTTCCGGTCCCTAAT pLKO_005 462 CDS 100% 10.800 15.120 N Thegl n/a
4 TRCN0000216734 GGTAGACACAAGTTAGGTATC pLKO.1 1528 3UTR 100% 6.000 4.800 N Thegl n/a
5 TRCN0000268955 ACTACGACCCAAACGTCTTTA pLKO_005 1415 CDS 100% 13.200 9.240 N Thegl n/a
6 TRCN0000268905 CTACTTGCTAATCCTAGTAAA pLKO_005 1234 CDS 100% 13.200 9.240 N Thegl n/a
7 TRCN0000268956 TCTAGACCGTGCGGCAGATAA pLKO_005 1547 3UTR 100% 13.200 9.240 N Thegl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.