Transcript: Mouse NM_027979.2

Mus musculus chitinase 1 (chitotriosidase) (Chit1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Chit1 (71884)
Length:
1815
CDS:
229..1623

Additional Resources:

NCBI RefSeq record:
NM_027979.2
NBCI Gene record:
Chit1 (71884)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111283 GCCTACCTATGGACGCTCTTT pLKO.1 1020 CDS 100% 4.950 3.960 N Chit1 n/a
2 TRCN0000111282 CGGCAGGAACTAAATCTTCCA pLKO.1 1366 CDS 100% 2.640 2.112 N Chit1 n/a
3 TRCN0000111284 CCACAGTAGACAAAGAGAGAT pLKO.1 671 CDS 100% 4.950 3.465 N Chit1 n/a
4 TRCN0000111280 GCTTGGATTTCATCAACCTTA pLKO.1 836 CDS 100% 4.950 3.465 N Chit1 n/a
5 TRCN0000111281 CCTTTGTGAAGTCAGCCCTAA pLKO.1 581 CDS 100% 4.050 2.430 N Chit1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.