Transcript: Mouse NM_028001.3

Mus musculus junctional sarcoplasmic reticulum protein 1 (Jsrp1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Jsrp1 (71912)
Length:
1116
CDS:
42..1040

Additional Resources:

NCBI RefSeq record:
NM_028001.3
NBCI Gene record:
Jsrp1 (71912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246685 TAGAACGTGGAGGGTCCATCT pLKO_005 694 CDS 100% 4.050 5.670 N Jsrp1 n/a
2 TRCN0000179984 CGGAAAGAGAAGCCAAGTAAA pLKO.1 774 CDS 100% 13.200 9.240 N Jsrp1 n/a
3 TRCN0000257737 GAAGCCGAGGAGAGAGGATAA pLKO_005 830 CDS 100% 10.800 7.560 N Jsrp1 n/a
4 TRCN0000257731 GGAGATCTGACGCTCAACAAG pLKO_005 411 CDS 100% 4.950 3.465 N Jsrp1 n/a
5 TRCN0000184425 GAGGATAAGTCACAGGTCACT pLKO.1 843 CDS 100% 2.640 1.848 N Jsrp1 n/a
6 TRCN0000246683 GGAAAGAGAAGCCAAGTAAAG pLKO_005 775 CDS 100% 10.800 6.480 N Jsrp1 n/a
7 TRCN0000246684 TGAAGAAGGAGAAGCCGAGAA pLKO_005 805 CDS 100% 4.050 2.430 N Jsrp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.