Transcript: Mouse NM_028014.3

Mus musculus transmembrane protein 94 (Tmem94), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tmem94 (71947)
Length:
4996
CDS:
228..4310

Additional Resources:

NCBI RefSeq record:
NM_028014.3
NBCI Gene record:
Tmem94 (71947)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028014.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328508 GAGCCCTACCCTCATCATAAA pLKO_005 1731 CDS 100% 13.200 18.480 N Tmem94 n/a
2 TRCN0000191733 GATTGTAAAGTTACACGAGAT pLKO.1 4214 CDS 100% 4.050 5.670 N Tmem94 n/a
3 TRCN0000328562 GATTGTAAAGTTACACGAGAT pLKO_005 4214 CDS 100% 4.050 5.670 N Tmem94 n/a
4 TRCN0000412471 ACCATGTGTGAGATGATAAAG pLKO_005 3183 CDS 100% 13.200 9.240 N TMEM94 n/a
5 TRCN0000328507 CATTGCCCTGGATCCCTTATA pLKO_005 3293 CDS 100% 13.200 9.240 N Tmem94 n/a
6 TRCN0000192203 CCAGGAAGTTGGTATCACAAA pLKO.1 4367 3UTR 100% 4.950 3.465 N Tmem94 n/a
7 TRCN0000189444 CCATGTATCCAGACCTCCATA pLKO.1 676 CDS 100% 4.950 3.465 N Tmem94 n/a
8 TRCN0000328561 CCATGTATCCAGACCTCCATA pLKO_005 676 CDS 100% 4.950 3.465 N Tmem94 n/a
9 TRCN0000191657 GAAGTTGGTATCACAAATGTT pLKO.1 4371 3UTR 100% 5.625 3.375 N Tmem94 n/a
10 TRCN0000328506 GAAGTTGGTATCACAAATGTT pLKO_005 4371 3UTR 100% 5.625 3.375 N Tmem94 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028014.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.