Transcript: Mouse NM_028019.3

Mus musculus ring finger protein 135 (Rnf135), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rnf135 (71956)
Length:
1959
CDS:
46..1299

Additional Resources:

NCBI RefSeq record:
NM_028019.3
NBCI Gene record:
Rnf135 (71956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028019.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304948 ACTTAGGGAGACTGGATATAG pLKO_005 1364 3UTR 100% 13.200 18.480 N Rnf135 n/a
2 TRCN0000040987 CTCCATAACCTGGAAGAAATT pLKO.1 613 CDS 100% 13.200 9.240 N Rnf135 n/a
3 TRCN0000311190 GACGACCTGAGCTGCATTATC pLKO_005 94 CDS 100% 13.200 9.240 N Rnf135 n/a
4 TRCN0000040983 CCTGGAAATAAAGCAGCTAAA pLKO.1 1272 CDS 100% 10.800 7.560 N Rnf135 n/a
5 TRCN0000302814 CCTGGAAATAAAGCAGCTAAA pLKO_005 1272 CDS 100% 10.800 7.560 N Rnf135 n/a
6 TRCN0000040984 GACCTTCAGTATATCTCAGAA pLKO.1 576 CDS 100% 4.950 3.465 N Rnf135 n/a
7 TRCN0000302816 GACCTTCAGTATATCTCAGAA pLKO_005 576 CDS 100% 4.950 3.465 N Rnf135 n/a
8 TRCN0000040985 GACGATGTCAAGAGCCTTCAA pLKO.1 451 CDS 100% 4.950 3.465 N Rnf135 n/a
9 TRCN0000302815 GACGATGTCAAGAGCCTTCAA pLKO_005 451 CDS 100% 4.950 3.465 N Rnf135 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028019.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.