Transcript: Mouse NM_028089.3

Mus musculus cytochrome P450, family 2, subfamily c, polypeptide 55 (Cyp2c55), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Cyp2c55 (72082)
Length:
1989
CDS:
28..1500

Additional Resources:

NCBI RefSeq record:
NM_028089.3
NBCI Gene record:
Cyp2c55 (72082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028089.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173964 GCAGAGATCGATCACGTGATT pLKO.1 1000 CDS 100% 4.950 6.930 N Cyp2c55 n/a
2 TRCN0000193674 CCTGTCAACTATTAGGGACAT pLKO.1 1564 3UTR 100% 4.050 5.670 N Cyp2c55 n/a
3 TRCN0000219590 TGGCCACTGTAACCGACATAT pLKO.1 890 CDS 100% 13.200 9.240 N Cyp2c55 n/a
4 TRCN0000193675 CCTCTTCAGTCTACAACACTT pLKO.1 1691 3UTR 100% 4.950 3.465 N Cyp2c55 n/a
5 TRCN0000174664 GAAACCACAAACATTACTCTA pLKO.1 925 CDS 100% 4.950 3.465 N Cyp2c55 n/a
6 TRCN0000194021 GAGTGAAAGAACACCAGGAAA pLKO.1 767 CDS 100% 4.950 3.465 N Cyp2c55 n/a
7 TRCN0000193770 CCATGGTACATGAGATTCAGA pLKO.1 1076 CDS 100% 3.000 2.100 N Cyp2c55 n/a
8 TRCN0000174890 GCTTTGCTTGACTCAAAGTAA pLKO.1 1794 3UTR 100% 0.563 0.394 N Cyp2c55 n/a
9 TRCN0000174372 CCCTTTCCCAATTATTGGAAA pLKO.1 129 CDS 100% 0.495 0.347 N Cyp2c55 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028089.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.