Transcript: Mouse NM_028104.4

Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 14D (Ppp1r14d), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r14d (72112)
Length:
746
CDS:
67..507

Additional Resources:

NCBI RefSeq record:
NM_028104.4
NBCI Gene record:
Ppp1r14d (72112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028104.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201365 GACTTGTCAACAGAAGATCAA pLKO.1 373 CDS 100% 4.950 3.960 N Ppp1r14d n/a
2 TRCN0000190744 GTCAAAGACTCACTTGGACAT pLKO.1 183 CDS 100% 4.050 3.240 N Ppp1r14d n/a
3 TRCN0000202396 GCTCTCATGGACTTGTCAACA pLKO.1 364 CDS 100% 4.950 3.465 N Ppp1r14d n/a
4 TRCN0000190497 GAATCTTCTGAGCCAGAGATT pLKO.1 334 CDS 100% 0.495 0.347 N Ppp1r14d n/a
5 TRCN0000189542 CCAGAGATTGATCTGGAAGCT pLKO.1 346 CDS 100% 0.264 0.185 N Ppp1r14d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028104.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.