Transcript: Mouse NM_028119.5

Mus musculus damage specific DNA binding protein 2 (Ddb2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ddb2 (107986)
Length:
1929
CDS:
251..1549

Additional Resources:

NCBI RefSeq record:
NM_028119.5
NBCI Gene record:
Ddb2 (107986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028119.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305100 CCCTATGAACTAAGGACAATA pLKO_005 1346 CDS 100% 13.200 18.480 N Ddb2 n/a
2 TRCN0000112130 GCCTCTACTATGGGTTATCAT pLKO.1 1472 CDS 100% 5.625 7.875 N Ddb2 n/a
3 TRCN0000308920 GCCTCTACTATGGGTTATCAT pLKO_005 1472 CDS 100% 5.625 7.875 N Ddb2 n/a
4 TRCN0000112134 CGGTATTACTTCGCTCAATGA pLKO.1 1426 CDS 100% 4.950 6.930 N Ddb2 n/a
5 TRCN0000305166 GCAACATTCTCAGAGTTTATA pLKO_005 813 CDS 100% 15.000 10.500 N Ddb2 n/a
6 TRCN0000305165 ATACCCAGATCCTAATCTTAA pLKO_005 1315 CDS 100% 13.200 9.240 N Ddb2 n/a
7 TRCN0000305164 CTAGCTTCTTACCAGGTATTC pLKO_005 542 CDS 100% 10.800 7.560 N Ddb2 n/a
8 TRCN0000112132 CCTGACTACTGACCAGAACAA pLKO.1 1159 CDS 100% 4.950 3.465 N Ddb2 n/a
9 TRCN0000112133 GCTGAAGTTTAACCATCTCAA pLKO.1 733 CDS 100% 4.950 3.465 N Ddb2 n/a
10 TRCN0000112131 CCTGCGCCAAATTAAAGGGAA pLKO.1 1063 CDS 100% 2.640 1.848 N Ddb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028119.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.