Transcript: Mouse NM_028146.4

Mus musculus dysbindin (dystrobrevin binding protein 1) domain containing 1 (Dbndd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dbndd1 (72185)
Length:
1681
CDS:
91..675

Additional Resources:

NCBI RefSeq record:
NM_028146.4
NBCI Gene record:
Dbndd1 (72185)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028146.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182491 GTACATTTGGTGGCAGGTCAA pLKO.1 1099 3UTR 100% 4.050 3.240 N Dbndd1 n/a
2 TRCN0000197721 GTGATTCCAAACAGGTTCAAA pLKO.1 1000 3UTR 100% 5.625 3.938 N Dbndd1 n/a
3 TRCN0000176697 CAGGTCTTCTTTAGTTCAGAA pLKO.1 1302 3UTR 100% 4.950 3.465 N Dbndd1 n/a
4 TRCN0000200351 GACTACCGTAATGGCACCATA pLKO.1 715 3UTR 100% 4.950 3.465 N Dbndd1 n/a
5 TRCN0000176900 GTCTTCTTTAGTTCAGAACAT pLKO.1 1305 3UTR 100% 4.950 3.465 N Dbndd1 n/a
6 TRCN0000182237 CCCTGAATGTTTCAGCTCATG pLKO.1 257 CDS 100% 4.050 2.835 N Dbndd1 n/a
7 TRCN0000182118 CCCAAAGTACATTTGGTGGCA pLKO.1 1093 3UTR 100% 0.066 0.046 N Dbndd1 n/a
8 TRCN0000177831 CTTCCCTAAGATTTCCACCTT pLKO.1 1163 3UTR 100% 2.640 1.584 N Dbndd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028146.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.