Transcript: Mouse NM_028153.1

Mus musculus echinoderm microtubule associated protein like 2 (Eml2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Eml2 (72205)
Length:
2312
CDS:
35..2041

Additional Resources:

NCBI RefSeq record:
NM_028153.1
NBCI Gene record:
Eml2 (72205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089619 CCTGTTCGAGAAACACGAGAA pLKO.1 823 CDS 100% 4.050 5.670 N Eml2 n/a
2 TRCN0000089622 CCATGTGACTAATGTGGCCTT pLKO.1 1948 CDS 100% 2.160 3.024 N Eml2 n/a
3 TRCN0000089621 CTAAAGCTAGACTGGGTGTAT pLKO.1 197 CDS 100% 4.950 6.435 N Eml2 n/a
4 TRCN0000116540 CGACAACTTGGTGTACGTGTA pLKO.1 1531 CDS 100% 4.050 2.835 N EML2 n/a
5 TRCN0000286995 CGACAACTTGGTGTACGTGTA pLKO_005 1531 CDS 100% 4.050 2.835 N EML2 n/a
6 TRCN0000089620 GCTATCCACACAGATGGCAAT pLKO.1 1451 CDS 100% 4.050 2.835 N Eml2 n/a
7 TRCN0000089618 CAGTAATATATACCCAGAGTA pLKO.1 2118 3UTR 100% 4.950 2.970 N Eml2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.