Transcript: Mouse NM_028193.3

Mus musculus BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit (Brf1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Brf1 (72308)
Length:
2755
CDS:
266..2296

Additional Resources:

NCBI RefSeq record:
NM_028193.3
NBCI Gene record:
Brf1 (72308)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028193.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119899 GCCTGGACACAGCATTCAATT pLKO.1 582 CDS 100% 13.200 10.560 N Brf1 n/a
2 TRCN0000119898 GCCATTGAAATTGAGCTAGAA pLKO.1 1244 CDS 100% 4.950 3.960 N Brf1 n/a
3 TRCN0000119900 CCAACCAGTCAGCTCACTATT pLKO.1 1076 CDS 100% 13.200 9.240 N Brf1 n/a
4 TRCN0000119897 CCACGGCTCATAGGAATGATT pLKO.1 2376 3UTR 100% 5.625 3.938 N Brf1 n/a
5 TRCN0000119901 CCTTGAGATTGACAGATACAT pLKO.1 1624 CDS 100% 5.625 3.938 N Brf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028193.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.