Transcript: Mouse NM_028208.1

Mus musculus protein prenyltransferase alpha subunit repeat containing 1 (Ptar1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ptar1 (72351)
Length:
2064
CDS:
61..1335

Additional Resources:

NCBI RefSeq record:
NM_028208.1
NBCI Gene record:
Ptar1 (72351)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028208.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376246 CAGGTTTATTGATCAAGTATT pLKO_005 1239 CDS 100% 13.200 18.480 N Ptar1 n/a
2 TRCN0000367089 TATAGTTCCTTCCTACTAAAT pLKO_005 1518 3UTR 100% 13.200 18.480 N Ptar1 n/a
3 TRCN0000421157 ACTCTAGCAAGCAAGGCTATT pLKO_005 1154 CDS 100% 10.800 15.120 N PTAR1 n/a
4 TRCN0000376244 TGGTGTGTCAAGTTCTTATTA pLKO_005 235 CDS 100% 15.000 12.000 N Ptar1 n/a
5 TRCN0000376245 CAAGCGTGTTCTCCCGTTATC pLKO_005 1809 3UTR 100% 10.800 8.640 N Ptar1 n/a
6 TRCN0000367159 GAGAGGACACAGCGGATAATA pLKO_005 571 CDS 100% 15.000 10.500 N Ptar1 n/a
7 TRCN0000367158 TGGCACTTTAAGTCCAATTAA pLKO_005 402 CDS 100% 15.000 10.500 N Ptar1 n/a
8 TRCN0000367092 GATGAACTGTCTTCTACTAAA pLKO_005 712 CDS 100% 13.200 9.240 N Ptar1 n/a
9 TRCN0000036388 CATAGATGAAATTGGCCTGAT pLKO.1 144 CDS 100% 4.050 2.835 N PTAR1 n/a
10 TRCN0000367088 TCTACCTTCAGCATCACTTAA pLKO_005 1004 CDS 100% 13.200 7.920 N Ptar1 n/a
11 TRCN0000036387 GCATACAGGAAATGGCTGGTT pLKO.1 1300 CDS 100% 2.640 1.848 N PTAR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028208.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.