Transcript: Mouse NM_028387.1

Mus musculus MACRO domain containing 2 (Macrod2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Macrod2 (72899)
Length:
3552
CDS:
399..743

Additional Resources:

NCBI RefSeq record:
NM_028387.1
NBCI Gene record:
Macrod2 (72899)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241340 TTTGTTGCGTGTCTAACTAAC pLKO_005 690 CDS 100% 10.800 15.120 N Macrod2 n/a
2 TRCN0000241341 ACGTTTCCTGCTAGGATATAT pLKO_005 1753 3UTR 100% 15.000 12.000 N Macrod2 n/a
3 TRCN0000241338 TGAGAACTGAGAAGGTATTAA pLKO_005 734 CDS 100% 15.000 10.500 N Macrod2 n/a
4 TRCN0000183313 GCCCTTTATCTGATCTTGTTT pLKO.1 523 CDS 100% 5.625 3.938 N Macrod2 n/a
5 TRCN0000241337 CAAGAAGGGTGGGAGACACAT pLKO_005 664 CDS 100% 4.950 3.465 N Macrod2 n/a
6 TRCN0000179105 CTCCTTGAGAAGAGTCTGTTT pLKO.1 581 CDS 100% 4.950 3.465 N Macrod2 n/a
7 TRCN0000184452 GCAGCAGTTATGTCACGTCTA pLKO.1 1434 3UTR 100% 4.050 2.835 N Macrod2 n/a
8 TRCN0000241339 TGAACTTCCTGAAGGCAAACA pLKO_005 641 CDS 100% 4.950 2.970 N Macrod2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.