Transcript: Mouse NM_028404.2

Mus musculus DNA topoisomerase 1, mitochondrial (Top1mt), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Top1mt (72960)
Length:
2011
CDS:
35..1816

Additional Resources:

NCBI RefSeq record:
NM_028404.2
NBCI Gene record:
Top1mt (72960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028404.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114689 GCACGTTGTAGAGCTGGACTT pLKO.1 1087 CDS 100% 4.050 5.670 N Top1mt n/a
2 TRCN0000324175 GCACGTTGTAGAGCTGGACTT pLKO_005 1087 CDS 100% 4.050 5.670 N Top1mt n/a
3 TRCN0000114688 GCATCTTGAGTGTACGAGCAA pLKO.1 313 CDS 100% 2.640 3.696 N Top1mt n/a
4 TRCN0000324127 GCATCTTGAGTGTACGAGCAA pLKO_005 313 CDS 100% 2.640 3.696 N Top1mt n/a
5 TRCN0000114687 CGATTGTTAAAGCTGGAAGAA pLKO.1 1586 CDS 100% 4.950 3.960 N Top1mt n/a
6 TRCN0000324111 CGATTGTTAAAGCTGGAAGAA pLKO_005 1586 CDS 100% 4.950 3.960 N Top1mt n/a
7 TRCN0000114686 GCTGAAATGTTCTTTCTCACT pLKO.1 1831 3UTR 100% 2.640 1.848 N Top1mt n/a
8 TRCN0000324158 GCTGAAATGTTCTTTCTCACT pLKO_005 1831 3UTR 100% 2.640 1.848 N Top1mt n/a
9 TRCN0000114690 GCCAGAGGATGTGGTCATTAA pLKO.1 655 CDS 100% 13.200 7.920 N Top1mt n/a
10 TRCN0000324174 GCCAGAGGATGTGGTCATTAA pLKO_005 655 CDS 100% 13.200 7.920 N Top1mt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028404.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.