Transcript: Mouse NM_028472.2

Mus musculus BMP-binding endothelial regulator (Bmper), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Bmper (73230)
Length:
3806
CDS:
566..2623

Additional Resources:

NCBI RefSeq record:
NM_028472.2
NBCI Gene record:
Bmper (73230)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073560 GCGCTGTGTTGTTCATTGTAA pLKO.1 994 CDS 100% 5.625 3.938 N BMPER n/a
2 TRCN0000114778 GCTGTGAACGATGCAAAGGTT pLKO.1 867 CDS 100% 3.000 2.100 N Bmper n/a
3 TRCN0000114776 CCTCATTACTTATGTGTGCAA pLKO.1 3282 3UTR 100% 2.640 1.848 N Bmper n/a
4 TRCN0000114780 GCCACTCTACAGTGGACTATA pLKO.1 2277 CDS 100% 1.320 0.924 N Bmper n/a
5 TRCN0000114777 CCATGCAATAAGCCCTGCATT pLKO.1 2525 CDS 100% 0.495 0.347 N Bmper n/a
6 TRCN0000114779 GCCAGAAGGAAACAAATGTAT pLKO.1 1105 CDS 100% 5.625 3.375 N Bmper n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.