Transcript: Mouse NM_028538.1

Mus musculus zinc finger protein 974 (Zfp974), mRNA.

Source:
NCBI, updated 2017-04-25
Taxon:
Mus musculus (mouse)
Gene:
Zfp974 (73430)
Length:
5159
CDS:
253..2511

Additional Resources:

NCBI RefSeq record:
NM_028538.1
NBCI Gene record:
Zfp974 (73430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241359 TGGCCACAACCATAGTATATT pLKO_005 417 CDS 100% 15.000 12.000 N Zfp974 n/a
2 TRCN0000216434 GGAACCCTTTCATAATCATAA pLKO.1 2469 CDS 100% 13.200 10.560 N Zfp974 n/a
3 TRCN0000241357 GGAACCCTTTCATAATCATAA pLKO_005 2469 CDS 100% 13.200 10.560 N Zfp974 n/a
4 TRCN0000241358 TGTGGGTTGTATAGGATTATC pLKO_005 814 CDS 100% 13.200 10.560 N Zfp974 n/a
5 TRCN0000241360 AGTGGACTACAGGGTTATAAA pLKO_005 439 CDS 100% 15.000 10.500 N Zfp974 n/a
6 TRCN0000241361 CTATACTACAGAACCATAAAT pLKO_005 4297 3UTR 100% 15.000 10.500 N Zfp974 n/a
7 TRCN0000182967 CTTAGTAAACATCACACAGTT pLKO.1 1738 CDS 100% 4.950 3.465 N Zfp974 n/a
8 TRCN0000180380 GCCATTCATTCTGGTGTGAAA pLKO.1 2089 CDS 100% 4.950 3.465 N Zfp974 n/a
9 TRCN0000196118 GCGAGGAATGTGGGAACATTT pLKO.1 2625 3UTR 100% 1.320 0.792 N Zfp974 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.