Transcript: Mouse NM_028544.1

Mus musculus Ras interacting protein 1 (Rasip1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Rasip1 (69903)
Length:
3169
CDS:
59..2944

Additional Resources:

NCBI RefSeq record:
NM_028544.1
NBCI Gene record:
Rasip1 (69903)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028544.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215681 GAAACTGCATCGCTTCTTAAA pLKO.1 2975 3UTR 100% 13.200 18.480 N Rasip1 n/a
2 TRCN0000176260 CGACCTTTCTATCAATGGTCT pLKO.1 2432 CDS 100% 2.640 3.696 N Rasip1 n/a
3 TRCN0000173853 CTCAACTCACTGATGGAACGA pLKO.1 2402 CDS 100% 2.640 2.112 N Rasip1 n/a
4 TRCN0000217163 CTACCTCACCAAGACTCTTTA pLKO.1 2167 CDS 100% 13.200 9.240 N Rasip1 n/a
5 TRCN0000437267 CCACTGAGTTCTTCCGGAAAC pLKO_005 2526 CDS 100% 6.000 4.200 N RASIP1 n/a
6 TRCN0000175045 GAAACTTTCCATTGCTGTGAA pLKO.1 2542 CDS 100% 4.950 3.465 N Rasip1 n/a
7 TRCN0000194124 GATGACGCATTGCATAGAGAA pLKO.1 2831 CDS 100% 4.950 3.465 N Rasip1 n/a
8 TRCN0000077905 CAGCTCTGCAATGACTTGGAA pLKO.1 2081 CDS 100% 3.000 2.100 N RASIP1 n/a
9 TRCN0000216713 CAGAACCAACTTGGATCTTGT pLKO.1 2467 CDS 100% 4.950 2.970 N Rasip1 n/a
10 TRCN0000175952 GAAAGTGCTAGAGATGGAGAA pLKO.1 2026 CDS 100% 4.050 2.430 N Rasip1 n/a
11 TRCN0000077904 GCTCTGCAATGACTTGGAATT pLKO.1 2083 CDS 100% 0.000 0.000 N RASIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028544.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.