Transcript: Mouse NM_028560.4

Mus musculus phosphatidylethanolamine binding protein 4 (Pebp4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pebp4 (73523)
Length:
1092
CDS:
188..916

Additional Resources:

NCBI RefSeq record:
NM_028560.4
NBCI Gene record:
Pebp4 (73523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028560.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115215 AGTCAAGTTCCACACGGCTTT pLKO.1 487 CDS 100% 4.050 3.240 N Pebp4 n/a
2 TRCN0000115213 TGTTCCTAAGTGCAATCTATA pLKO.1 433 CDS 100% 13.200 9.240 N Pebp4 n/a
3 TRCN0000115214 CTATGCAGGAACCTAGAAGTT pLKO.1 377 CDS 100% 4.950 3.465 N Pebp4 n/a
4 TRCN0000115212 GTGCAATCTATACAGACAGAA pLKO.1 442 CDS 100% 4.950 3.465 N Pebp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028560.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.