Transcript: Mouse NM_028561.2

Mus musculus spermatogenesis associated glutamate (E)-rich protein 4B (Speer4b), mRNA.

Source:
NCBI, updated 2015-06-25
Taxon:
Mus musculus (mouse)
Gene:
Speer4b (73526)
Length:
1977
CDS:
26..829

Additional Resources:

NCBI RefSeq record:
NM_028561.2
NBCI Gene record:
Speer4b (73526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028561.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192343 CTAGCTAATTGGGCCATCATT pLKO.1 551 CDS 100% 5.625 7.875 N Speer4b n/a
2 TRCN0000249992 GATCTTCGTGTGTCGATAATT pLKO_005 1335 3UTR 100% 15.000 10.500 N Speer4b n/a
3 TRCN0000249993 GCAAGGAAGTACTAGCTAATT pLKO_005 540 CDS 100% 13.200 7.920 N Speer4b n/a
4 TRCN0000434795 AGCTCAAGAAGGAGATAAATT pLKO_005 441 CDS 100% 15.000 7.500 Y Speer4f1 n/a
5 TRCN0000249995 GAGCTCAAGAAGGAGATAAAT pLKO_005 440 CDS 100% 15.000 7.500 Y Speer4b n/a
6 TRCN0000200832 GCTGGAGGAGAATCTTATAAA pLKO.1 490 CDS 100% 15.000 7.500 Y Speer4a n/a
7 TRCN0000246387 TGCTGGAGGAGAATCTTATAA pLKO_005 489 CDS 100% 15.000 7.500 Y Speer4a n/a
8 TRCN0000176553 CCTCAGATGAATCTTCTTATA pLKO.1 786 CDS 100% 13.200 6.600 Y 5031410I06Rik n/a
9 TRCN0000284246 CTCACTACCGAGGAGACAAAT pLKO_005 254 CDS 100% 13.200 6.600 Y Gm10220 n/a
10 TRCN0000270314 GAGAAGGAGATCATGACATAT pLKO_005 371 CDS 100% 13.200 6.600 Y Gm10220 n/a
11 TRCN0000284248 AGTTGAACCTGAGTGGTAAAG pLKO_005 588 CDS 100% 10.800 5.400 Y Gm10220 n/a
12 TRCN0000249994 TAAAGAAGAAGTTGGCGATAT pLKO_005 507 CDS 100% 10.800 5.400 Y Speer4b n/a
13 TRCN0000249996 TGACATATCTACACGACTTAG pLKO_005 384 CDS 100% 10.800 5.400 Y Speer4b n/a
14 TRCN0000179250 GAGACAAATGAGCTGAGAGAT pLKO.1 266 CDS 100% 4.950 2.475 Y Gm9758 n/a
15 TRCN0000197727 GCTAACATATAGCACTCTATA pLKO.1 1433 3UTR 100% 1.320 0.660 Y 5031410I06Rik n/a
16 TRCN0000255101 GAGAAGGAGATCATGACATTT pLKO_005 371 CDS 100% 13.200 6.600 Y Speer4e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028561.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.