Transcript: Mouse NM_028599.2

Mus musculus WD repeat domain 75 (Wdr75), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Wdr75 (73674)
Length:
2612
CDS:
22..2514

Additional Resources:

NCBI RefSeq record:
NM_028599.2
NBCI Gene record:
Wdr75 (73674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253313 TCTTGATGCATCGGCAGTAAT pLKO_005 978 CDS 100% 13.200 18.480 N Wdr75 n/a
2 TRCN0000253312 CTAGTTAAAGATAGGAGTATA pLKO_005 1006 CDS 100% 0.000 0.000 N Wdr75 n/a
3 TRCN0000215864 CCTCGATTAGGATCTTCTATT pLKO.1 877 CDS 100% 13.200 10.560 N Wdr75 n/a
4 TRCN0000215786 CACTTCAAAGTGTGGATATTA pLKO.1 1423 CDS 100% 15.000 10.500 N Wdr75 n/a
5 TRCN0000217190 CGAAGTCACAGAGCTTATTAA pLKO.1 1997 CDS 100% 15.000 10.500 N Wdr75 n/a
6 TRCN0000265373 CGAAGTCACAGAGCTTATTAA pLKO_005 1997 CDS 100% 15.000 10.500 N Wdr75 n/a
7 TRCN0000253311 CTCCGTGGATTCCAAGTATAT pLKO_005 90 CDS 100% 13.200 9.240 N Wdr75 n/a
8 TRCN0000265365 CATCAATGATGAGGGTCTAAC pLKO_005 1155 CDS 100% 10.800 7.560 N Wdr75 n/a
9 TRCN0000190522 GCTGTTGGAATCTGCTCAGTT pLKO.1 1715 CDS 100% 4.950 3.465 N Wdr75 n/a
10 TRCN0000156055 CCAACAAGCAAACAGCTGCTA pLKO.1 2053 CDS 100% 2.640 1.848 N WDR75 n/a
11 TRCN0000151800 CCAGATATATTTCAGCTGGTT pLKO.1 388 CDS 100% 2.640 1.848 N WDR75 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.