Transcript: Mouse NM_028603.4

Mus musculus zinc finger and BTB domain containing 8a (Zbtb8a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Zbtb8a (73680)
Length:
2229
CDS:
385..1689

Additional Resources:

NCBI RefSeq record:
NM_028603.4
NBCI Gene record:
Zbtb8a (73680)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028603.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321539 ACCGTCTGAAGTCGTTCATTT pLKO_005 1017 CDS 100% 13.200 18.480 N Zbtb8a n/a
2 TRCN0000321600 TTGCAAGCAGCGGCTACTTTA pLKO_005 512 CDS 100% 13.200 18.480 N Zbtb8a n/a
3 TRCN0000084790 GCGCATCGGAATGTCTTGTTT pLKO.1 493 CDS 100% 5.625 4.500 N Zbtb8a n/a
4 TRCN0000321599 AGTAGCCATTTCCGAACTATT pLKO_005 1339 CDS 100% 13.200 9.240 N Zbtb8a n/a
5 TRCN0000350637 TGGCATGACAGATGATCAATT pLKO_005 1889 3UTR 100% 13.200 9.240 N Zbtb8a n/a
6 TRCN0000321598 AGTCATCCTGGACTTCGTATA pLKO_005 615 CDS 100% 10.800 7.560 N Zbtb8a n/a
7 TRCN0000084792 CTCTCTCTTACGGGACAGAAT pLKO.1 646 CDS 100% 4.950 3.465 N Zbtb8a n/a
8 TRCN0000084788 GCCTGCAATTTACACAGACAT pLKO.1 1719 3UTR 100% 4.950 3.465 N Zbtb8a n/a
9 TRCN0000084789 GCTTCGGTTCAAATGCCCATT pLKO.1 1200 CDS 100% 4.050 2.835 N Zbtb8a n/a
10 TRCN0000084791 CGAGGAAGAGAATAGATCCTA pLKO.1 1569 CDS 100% 3.000 2.100 N Zbtb8a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028603.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.