Transcript: Mouse NM_028615.1

Mus musculus developmental pluripotency associated 2 (Dppa2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Dppa2 (73703)
Length:
1941
CDS:
234..1139

Additional Resources:

NCBI RefSeq record:
NM_028615.1
NBCI Gene record:
Dppa2 (73703)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193899 CGGAGACACTCCTATTCTAAA pLKO.1 579 CDS 100% 13.200 18.480 N Dppa2 n/a
2 TRCN0000346074 CTCGTGCTGGATTGGCTAAAT pLKO_005 1436 3UTR 100% 13.200 18.480 N Dppa2 n/a
3 TRCN0000175923 GACTACGCTACGCAATCAAAT pLKO.1 348 CDS 100% 13.200 18.480 N Dppa2 n/a
4 TRCN0000279523 GACTACGCTACGCAATCAAAT pLKO_005 348 CDS 100% 13.200 18.480 N Dppa2 n/a
5 TRCN0000279567 CTAACAACACCTCGCTGTATC pLKO_005 1388 3UTR 100% 10.800 15.120 N Dppa2 n/a
6 TRCN0000174599 GCTACGCAATCAAATGTTTCT pLKO.1 354 CDS 100% 4.950 6.930 N Dppa2 n/a
7 TRCN0000193392 CGCAATCAAATGTTTCTTCTT pLKO.1 358 CDS 100% 4.950 3.960 N Dppa2 n/a
8 TRCN0000174598 GAGTGGAAGATAATTTGCTAT pLKO.1 1021 CDS 100% 4.950 3.465 N Dppa2 n/a
9 TRCN0000279564 GAGTGGAAGATAATTTGCTAT pLKO_005 1021 CDS 100% 4.950 3.465 N Dppa2 n/a
10 TRCN0000194082 GCTGGATTTGCATCACTCTAA pLKO.1 1371 3UTR 100% 4.950 3.465 N Dppa2 n/a
11 TRCN0000175886 GAATCAAACACCCAACCAGAA pLKO.1 427 CDS 100% 4.050 2.835 N Dppa2 n/a
12 TRCN0000176284 GCAGATAAGAAAGGTTGGGTT pLKO.1 903 CDS 100% 2.640 1.848 N Dppa2 n/a
13 TRCN0000346089 TCATGGCCTCGTGCTGGATTT pLKO_005 1359 3UTR 100% 10.800 6.480 N Dppa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.