Transcript: Mouse NM_028747.2

Mus musculus thioesterase superfamily member 7 (Them7), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Them7 (74088)
Length:
1598
CDS:
75..746

Additional Resources:

NCBI RefSeq record:
NM_028747.2
NBCI Gene record:
Them7 (74088)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182656 GCCACCCTAAATTAGCACAGT pLKO.1 601 CDS 100% 2.640 3.696 N Them7 n/a
2 TRCN0000178448 GTCAATCACCATGATCTCATT pLKO.1 564 CDS 100% 4.950 3.960 N Them7 n/a
3 TRCN0000178502 CCATGATCTCATTGATGGTTT pLKO.1 572 CDS 100% 4.950 3.465 N Them7 n/a
4 TRCN0000178582 CCCTAAATTAGCACAGTTTGA pLKO.1 605 CDS 100% 4.950 3.465 N Them7 n/a
5 TRCN0000182276 GAAGCTGATGAGTCCAGCATA pLKO.1 725 CDS 100% 4.950 3.465 N Them7 n/a
6 TRCN0000178270 GCCTTTGAAATGGTTGTCAAT pLKO.1 849 3UTR 100% 4.950 3.465 N Them7 n/a
7 TRCN0000177861 CCAATATCTTATCAGCAGGTT pLKO.1 1243 3UTR 100% 2.640 1.848 N Them7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.