Transcript: Mouse NM_028752.3

Mus musculus hydrogen voltage-gated channel 1 (Hvcn1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Hvcn1 (74096)
Length:
2652
CDS:
218..1027

Additional Resources:

NCBI RefSeq record:
NM_028752.3
NBCI Gene record:
Hvcn1 (74096)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028752.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173376 GCTGGTTTGTACCTCTCAAAT pLKO.1 1677 3UTR 100% 13.200 9.240 N Hvcn1 n/a
2 TRCN0000193753 CCCTGTAATTAGCACAATCTT pLKO.1 1612 3UTR 100% 5.625 3.938 N Hvcn1 n/a
3 TRCN0000173402 GCAGCTCTTTCAGTTACTGTA pLKO.1 1461 3UTR 100% 4.950 3.465 N Hvcn1 n/a
4 TRCN0000161821 CACAAGTTTGAGATCCTGGAT pLKO.1 707 CDS 100% 2.640 1.848 N HVCN1 n/a
5 TRCN0000193195 CTTAAGGCTAAAGCAGATAAA pLKO.1 889 CDS 100% 13.200 7.920 N Hvcn1 n/a
6 TRCN0000428229 ACAGGTTTCAGGTCATCATCA pLKO_005 501 CDS 100% 4.950 2.970 N HVCN1 n/a
7 TRCN0000174043 CCACAGGTTTCAGGTCATCAT pLKO.1 499 CDS 100% 4.950 2.970 N Hvcn1 n/a
8 TRCN0000176019 GTGGAATGTCAACTACAAGAA pLKO.1 328 CDS 100% 4.950 2.970 N Hvcn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028752.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.