Transcript: Mouse NM_028759.1

Mus musculus DDB1 and CUL4 associated factor 6 (Dcaf6), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dcaf6 (74106)
Length:
3306
CDS:
237..2867

Additional Resources:

NCBI RefSeq record:
NM_028759.1
NBCI Gene record:
Dcaf6 (74106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028759.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239166 GTTGGCGTCACTGAATCATAT pLKO_005 2774 CDS 100% 13.200 18.480 N Dcaf6 n/a
2 TRCN0000239167 GACAGCTCAGTACGGATTTAT pLKO_005 873 CDS 100% 15.000 12.000 N Dcaf6 n/a
3 TRCN0000239165 GGTTCCATCAAGTCCTAATTT pLKO_005 1391 CDS 100% 15.000 10.500 N Dcaf6 n/a
4 TRCN0000239164 TGGAATGGTTGCTCGATTTAT pLKO_005 950 CDS 100% 15.000 10.500 N Dcaf6 n/a
5 TRCN0000239163 TGAGATTTGTATACGACATTT pLKO_005 2897 3UTR 100% 13.200 9.240 N Dcaf6 n/a
6 TRCN0000129155 GAGCATTTGATGCTTCTGGAA pLKO.1 2538 CDS 100% 2.640 1.848 N DCAF6 n/a
7 TRCN0000344155 GAGCATTTGATGCTTCTGGAA pLKO_005 2538 CDS 100% 2.640 1.848 N DCAF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028759.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.