Transcript: Mouse NM_028772.3

Mus musculus dimethylglycine dehydrogenase precursor (Dmgdh), mRNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
Dmgdh (74129)
Length:
2979
CDS:
12..2621

Additional Resources:

NCBI RefSeq record:
NM_028772.3
NBCI Gene record:
Dmgdh (74129)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028772.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415406 GAAGATTCTGCGACGCTTTAT pLKO_005 2055 CDS 100% 13.200 18.480 N Dmgdh n/a
2 TRCN0000426850 ACATCATCAATGTCGTCAATG pLKO_005 1078 CDS 100% 10.800 15.120 N Dmgdh n/a
3 TRCN0000438320 ATCCCAATCGCTACGGCAAAT pLKO_005 1273 CDS 100% 10.800 15.120 N Dmgdh n/a
4 TRCN0000041921 CCAGCCACCATTATACAAGAA pLKO.1 2505 CDS 100% 4.950 3.960 N Dmgdh n/a
5 TRCN0000174063 CCAGCCACCATTATACAAGAA pLKO.1 2505 CDS 100% 4.950 3.960 N Dmgdh n/a
6 TRCN0000041922 CCGAGAATCATATGGGTTCAA pLKO.1 1325 CDS 100% 0.000 0.000 N Dmgdh n/a
7 TRCN0000041919 GCCACGGAACAGTATATTATT pLKO.1 462 CDS 100% 15.000 10.500 N Dmgdh n/a
8 TRCN0000041918 CCAGATCAGTATCTTTGTAAA pLKO.1 2699 3UTR 100% 13.200 9.240 N Dmgdh n/a
9 TRCN0000041920 CCCGGGATAAACTTGAAGAAA pLKO.1 291 CDS 100% 5.625 3.938 N Dmgdh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028772.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.