Transcript: Mouse NM_028812.3

Mus musculus general transcription factor II E, polypeptide 1 (alpha subunit) (Gtf2e1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gtf2e1 (74197)
Length:
3058
CDS:
143..1465

Additional Resources:

NCBI RefSeq record:
NM_028812.3
NBCI Gene record:
Gtf2e1 (74197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028812.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085171 CCTCATCATCATCGCGATGAA pLKO.1 1265 CDS 100% 0.495 0.693 N Gtf2e1 n/a
2 TRCN0000331587 CCTCATCATCATCGCGATGAA pLKO_005 1265 CDS 100% 0.495 0.693 N Gtf2e1 n/a
3 TRCN0000085168 CCTTGTATAAAGTGATGACAT pLKO.1 2616 3UTR 100% 4.950 3.960 N Gtf2e1 n/a
4 TRCN0000301972 CCTTGTATAAAGTGATGACAT pLKO_005 2616 3UTR 100% 4.950 3.960 N Gtf2e1 n/a
5 TRCN0000085172 ACTGACCTAGAAGCCAATCAA pLKO.1 551 CDS 100% 5.625 3.938 N Gtf2e1 n/a
6 TRCN0000301907 ACTGACCTAGAAGCCAATCAA pLKO_005 551 CDS 100% 5.625 3.938 N Gtf2e1 n/a
7 TRCN0000085169 CGTATGTTTGAGGATCTCTTT pLKO.1 1439 CDS 100% 4.950 3.465 N Gtf2e1 n/a
8 TRCN0000301973 CGTATGTTTGAGGATCTCTTT pLKO_005 1439 CDS 100% 4.950 3.465 N Gtf2e1 n/a
9 TRCN0000085170 GAAGCCAATCAACTGTTTGAT pLKO.1 560 CDS 100% 0.563 0.394 N Gtf2e1 n/a
10 TRCN0000020722 CCATAACTACTACTTCATCAA pLKO.1 406 CDS 100% 4.950 2.475 Y GTF2E1 n/a
11 TRCN0000277958 CCATAACTACTACTTCATCAA pLKO_005 406 CDS 100% 4.950 2.475 Y GTF2E1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028812.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.