Transcript: Mouse NM_028846.5

Mus musculus ubiquitin specific peptidase 20 (Usp20), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Usp20 (74270)
Length:
4157
CDS:
236..2986

Additional Resources:

NCBI RefSeq record:
NM_028846.5
NBCI Gene record:
Usp20 (74270)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028846.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037239 CCGTCGTATGTGCTCAAGAAA pLKO.1 1496 CDS 100% 5.625 7.875 N Usp20 n/a
2 TRCN0000037243 CCTATTGCTGTGGCTGATGAA pLKO.1 602 CDS 100% 4.950 6.930 N Usp20 n/a
3 TRCN0000037241 CGGTGTAAGAAGCTTCGGAAT pLKO.1 1925 CDS 100% 4.050 5.670 N Usp20 n/a
4 TRCN0000037242 CCCGAGAATGGCTCAACAAAT pLKO.1 2379 CDS 100% 13.200 10.560 N Usp20 n/a
5 TRCN0000037240 CCCACCCAACAAATACCACTA pLKO.1 2464 CDS 100% 4.050 2.430 N Usp20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028846.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.