Transcript: Mouse NM_028882.4

Mus musculus sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D (Sema3d), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Sema3d (108151)
Length:
6521
CDS:
547..2880

Additional Resources:

NCBI RefSeq record:
NM_028882.4
NBCI Gene record:
Sema3d (108151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028882.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112283 CCTATAATAAGACTCACGTTT pLKO.1 956 CDS 100% 4.950 6.930 N Sema3d n/a
2 TRCN0000112282 CCCTATAATAAGACTCACGTT pLKO.1 955 CDS 100% 2.640 3.696 N Sema3d n/a
3 TRCN0000444581 TATGCTGAGTAAGACTATATA pLKO_005 3004 3UTR 100% 15.000 10.500 N Sema3d n/a
4 TRCN0000373414 ACCTATGACCCACTGATTAAG pLKO_005 1750 CDS 100% 13.200 9.240 N SEMA3D n/a
5 TRCN0000444842 AGATATGCACCCACGTCTAAA pLKO_005 2227 CDS 100% 13.200 9.240 N Sema3d n/a
6 TRCN0000112280 CCACTTAGTAAGGGCGTTATT pLKO.1 3170 3UTR 100% 13.200 9.240 N Sema3d n/a
7 TRCN0000063214 CCTGTAGTATATGGAGTCTTT pLKO.1 1561 CDS 100% 4.950 3.465 N SEMA3D n/a
8 TRCN0000112281 GCAGTCTTTAATGGTCCCTAT pLKO.1 1645 CDS 100% 4.050 2.835 N Sema3d n/a
9 TRCN0000112284 GCACACTTTCATCCACACCAT pLKO.1 2553 CDS 100% 2.640 1.848 N Sema3d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028882.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.