Transcript: Mouse NM_028883.2

Mus musculus TBC/LysM associated domain containing 1 (Tldc1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tldc1 (74347)
Length:
2574
CDS:
80..1447

Additional Resources:

NCBI RefSeq record:
NM_028883.2
NBCI Gene record:
Tldc1 (74347)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264745 GAGGACTTCCTGTTCGATAAG pLKO_005 1268 CDS 100% 10.800 15.120 N Tldc1 n/a
2 TRCN0000200538 CCACTTCATGTACTTGAATTA pLKO.1 1102 CDS 100% 13.200 10.560 N Tldc1 n/a
3 TRCN0000264749 CCTGCACACGGGCTACAATAA pLKO_005 1081 CDS 100% 13.200 9.240 N Tldc1 n/a
4 TRCN0000216735 GATGGTCACCAGACTGTATAA pLKO.1 256 CDS 100% 13.200 9.240 N Tldc1 n/a
5 TRCN0000264748 ACAGGGATGGCTACGTCTTTG pLKO_005 966 CDS 100% 10.800 7.560 N Tldc1 n/a
6 TRCN0000264747 GAGCAGAGAGCGTCTAGATTC pLKO_005 1522 3UTR 100% 10.800 7.560 N Tldc1 n/a
7 TRCN0000264746 GATGCAGAGGGTCCTACAAAG pLKO_005 419 CDS 100% 10.800 7.560 N Tldc1 n/a
8 TRCN0000200559 CCTAATGGTTATGAACATGAT pLKO.1 394 CDS 100% 4.950 3.465 N Tldc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.