Transcript: Mouse NM_028935.1

Mus musculus zinc finger protein 558 (Zfp558), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zfp558 (72230)
Length:
3839
CDS:
403..1626

Additional Resources:

NCBI RefSeq record:
NM_028935.1
NBCI Gene record:
Zfp558 (72230)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225645 CCTCGCTCACTGGACATAATA pLKO_005 1247 CDS 100% 15.000 21.000 N Zfp558 n/a
2 TRCN0000218902 ACTGAGTTCTTGACAAGTTTG pLKO_005 496 CDS 100% 10.800 15.120 N Zfp558 n/a
3 TRCN0000225644 GCTAACTCCTAAGAATCTTAT pLKO_005 774 CDS 100% 13.200 10.560 N Zfp558 n/a
4 TRCN0000225643 AGATTTGGAGAAGGTACTTAA pLKO_005 744 CDS 100% 13.200 9.240 N Zfp558 n/a
5 TRCN0000218108 AGTCAATGAGTGCAATCAATG pLKO_005 864 CDS 100% 10.800 7.560 N Zfp558 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.