Transcript: Mouse NM_028953.2

Mus musculus transmembrane channel-like gene family 1 (Tmc1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tmc1 (13409)
Length:
4073
CDS:
164..2437

Additional Resources:

NCBI RefSeq record:
NM_028953.2
NBCI Gene record:
Tmc1 (13409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028953.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068887 CCTCATCATGTTACCGGAGTA pLKO.1 769 CDS 100% 4.050 3.240 N Tmc1 n/a
2 TRCN0000068883 CGGACCAGAGATGTCATCAAT pLKO.1 272 CDS 100% 5.625 3.938 N Tmc1 n/a
3 TRCN0000068885 GCAAGTGGATACCTCATCTTT pLKO.1 1277 CDS 100% 5.625 3.938 N Tmc1 n/a
4 TRCN0000068886 CCTGACCATCTATTATCTCAA pLKO.1 2284 CDS 100% 4.950 3.465 N Tmc1 n/a
5 TRCN0000044454 CCATCTATTATCTCAATGCTA pLKO.1 2289 CDS 100% 3.000 2.100 N TMC1 n/a
6 TRCN0000068884 GCTGGGACTTAGAATATGGAT pLKO.1 1827 CDS 100% 3.000 2.100 N Tmc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028953.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.