Transcript: Mouse NM_029023.3

Mus musculus serine carboxypeptidase 1 (Scpep1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Scpep1 (74617)
Length:
2087
CDS:
74..1432

Additional Resources:

NCBI RefSeq record:
NM_029023.3
NBCI Gene record:
Scpep1 (74617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029023.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032468 GTTCGTCAAGTCCTATGAGAA pLKO.1 1312 CDS 100% 4.950 6.930 N Scpep1 n/a
2 TRCN0000326108 GTTCGTCAAGTCCTATGAGAA pLKO_005 1312 CDS 100% 4.950 6.930 N Scpep1 n/a
3 TRCN0000032466 CCTATCGTTCTTACTGGGCTT pLKO.1 121 CDS 100% 2.160 1.728 N Scpep1 n/a
4 TRCN0000326110 CCTATCGTTCTTACTGGGCTT pLKO_005 121 CDS 100% 2.160 1.728 N Scpep1 n/a
5 TRCN0000032464 CCCAACTCAAGCCTCGAAATA pLKO.1 360 CDS 100% 13.200 9.240 N Scpep1 n/a
6 TRCN0000326181 CCCAACTCAAGCCTCGAAATA pLKO_005 360 CDS 100% 13.200 9.240 N Scpep1 n/a
7 TRCN0000032465 GATCTCATTGTGGACACCATA pLKO.1 1184 CDS 100% 4.950 3.465 N Scpep1 n/a
8 TRCN0000326106 GATCTCATTGTGGACACCATA pLKO_005 1184 CDS 100% 4.950 3.465 N Scpep1 n/a
9 TRCN0000032467 GCCCGGAGAAAGCTATGGAAT pLKO.1 903 CDS 100% 4.950 3.465 N Scpep1 n/a
10 TRCN0000326107 GCCCGGAGAAAGCTATGGAAT pLKO_005 903 CDS 100% 4.950 3.465 N Scpep1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029023.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.