Transcript: Mouse NM_029044.2

Mus musculus dynein regulatory complex subunit 3 (Drc3), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Drc3 (74665)
Length:
1858
CDS:
192..1763

Additional Resources:

NCBI RefSeq record:
NM_029044.2
NBCI Gene record:
Drc3 (74665)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088118 CCAGATTAGCAACATGATGAA pLKO.1 614 CDS 100% 4.950 3.960 N Drc3 n/a
2 TRCN0000088122 CTGGCTGGATTTGTCCTTTAA pLKO.1 461 CDS 100% 13.200 9.240 N Drc3 n/a
3 TRCN0000088119 CAGATTAGCAACATGATGAAT pLKO.1 615 CDS 100% 5.625 3.938 N Drc3 n/a
4 TRCN0000088120 CGAGTGAAGGAGATCAATCAA pLKO.1 1683 CDS 100% 5.625 3.938 N Drc3 n/a
5 TRCN0000088121 GAACACAAGATGGCGTTTGTT pLKO.1 894 CDS 100% 5.625 3.938 N Drc3 n/a
6 TRCN0000144314 CAAGGACAAGTTTGTCATCAT pLKO.1 1019 CDS 100% 4.950 3.465 N DRC3 n/a
7 TRCN0000139823 CCACCTCCTGAAGATTGACAA pLKO.1 1571 CDS 100% 4.950 3.465 N DRC3 n/a
8 TRCN0000139159 CCTCTGGCAGTTTGAGAACTT pLKO.1 371 CDS 100% 4.950 3.465 N DRC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.