Transcript: Mouse NM_029070.2

Mus musculus transmembrane protein 114 (Tmem114), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmem114 (74720)
Length:
1406
CDS:
485..1153

Additional Resources:

NCBI RefSeq record:
NM_029070.2
NBCI Gene record:
Tmem114 (74720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029070.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194555 GATCAGGTGGATATACGCTTT pLKO.1 1016 CDS 100% 4.050 5.670 N Tmem114 n/a
2 TRCN0000194320 CACTGGAATCAGCATCTACAT pLKO.1 934 CDS 100% 4.950 3.960 N Tmem114 n/a
3 TRCN0000173822 CACGGGACATTCGTGATCTTA pLKO.1 788 CDS 100% 5.625 3.938 N Tmem114 n/a
4 TRCN0000175714 GATTAGCTTTGTATCTGAGCT pLKO.1 1060 CDS 100% 2.640 1.848 N Tmem114 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029070.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.