Transcript: Mouse NM_029084.3

Mus musculus SLAM family member 8 (Slamf8), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Slamf8 (74748)
Length:
2040
CDS:
137..973

Additional Resources:

NCBI RefSeq record:
NM_029084.3
NBCI Gene record:
Slamf8 (74748)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100020 GCATTCTCTTTCTGGTCTGAA pLKO.1 1494 3UTR 100% 4.950 3.960 N Slamf8 n/a
2 TRCN0000100021 CCTCAATACCTGTCAGGTCTT pLKO.1 556 CDS 100% 4.050 2.835 N Slamf8 n/a
3 TRCN0000100024 CTCAAGGTGTACGATGCAGTA pLKO.1 485 CDS 100% 4.050 2.835 N Slamf8 n/a
4 TRCN0000100022 GCCAATTACACTGTTCCTGAT pLKO.1 847 CDS 100% 4.050 2.835 N Slamf8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.