Transcript: Mouse NM_029112.1

Mus musculus MORN repeat containing 3 (Morn3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Morn3 (74890)
Length:
942
CDS:
46..771

Additional Resources:

NCBI RefSeq record:
NM_029112.1
NBCI Gene record:
Morn3 (74890)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079065 GTACTACAACAACGGCGACAT pLKO.1 432 CDS 100% 4.050 5.670 N Morn3 n/a
2 TRCN0000079066 GCGATCACTACGTGGGCGAAT pLKO.1 149 CDS 100% 1.350 1.890 N Morn3 n/a
3 TRCN0000363058 TTCGGACCCAAGGAGTATTAC pLKO_005 367 CDS 100% 13.200 9.240 N Morn3 n/a
4 TRCN0000378416 AGAAGAGTGGTGCGGTCTATG pLKO_005 212 CDS 100% 10.800 7.560 N Morn3 n/a
5 TRCN0000363057 AGGCTGGTGGAAAGGCGATAA pLKO_005 321 CDS 100% 10.800 7.560 N Morn3 n/a
6 TRCN0000362984 GCTGAAGGAAGCGTTGGATAA pLKO_005 720 CDS 100% 10.800 7.560 N Morn3 n/a
7 TRCN0000079067 CTGGTGGAAAGGCGATAAGAA pLKO.1 324 CDS 100% 5.625 3.938 N Morn3 n/a
8 TRCN0000079064 CCCATACCTAAGGTGGAGATT pLKO.1 682 CDS 100% 4.950 3.465 N Morn3 n/a
9 TRCN0000155151 GAAACACGGGAAAGGAACACA pLKO.1 183 CDS 100% 3.000 2.100 N MORN3 n/a
10 TRCN0000079063 GTCAGCCGAAGCCTCTCCGTG pLKO.1 773 3UTR 100% 0.000 0.000 N Morn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.