Transcript: Mouse NM_029210.1

Mus musculus synaptic vesicle glycoprotein 2c (Sv2c), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Sv2c (75209)
Length:
4252
CDS:
232..2415

Additional Resources:

NCBI RefSeq record:
NM_029210.1
NBCI Gene record:
Sv2c (75209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341953 CACCGAACTGTACGGAATTTG pLKO_005 1464 CDS 100% 13.200 18.480 N Sv2c n/a
2 TRCN0000341952 GTAACGTGTAGCTGCGTATTG pLKO_005 2536 3UTR 100% 10.800 15.120 N Sv2c n/a
3 TRCN0000341957 TTCAAGAACTGCACGTTTATT pLKO_005 1825 CDS 100% 15.000 10.500 N Sv2c n/a
4 TRCN0000341955 ATAGATGAGCTGATCGAAATT pLKO_005 1396 CDS 100% 13.200 9.240 N Sv2c n/a
5 TRCN0000341956 GAGAAGGTCTTCACGGTAAAT pLKO_005 1354 CDS 100% 13.200 9.240 N Sv2c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07825 pDONR223 100% 88.8% 96.9% None (many diffs) n/a
2 ccsbBroad304_07825 pLX_304 0% 88.8% 96.9% V5 (many diffs) n/a
Download CSV