Transcript: Mouse NM_029211.2

Mus musculus ring finger protein 121 (Rnf121), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rnf121 (75212)
Length:
1502
CDS:
5..988

Additional Resources:

NCBI RefSeq record:
NM_029211.2
NBCI Gene record:
Rnf121 (75212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041118 GCAATCACGTATTCCATGAAT pLKO.1 756 CDS 100% 5.625 7.875 N Rnf121 n/a
2 TRCN0000041122 GCTCGAATGCATGCCAAACAT pLKO.1 116 CDS 100% 5.625 7.875 N Rnf121 n/a
3 TRCN0000375815 ATGCAATGGACTTTGGCATTT pLKO_005 525 CDS 100% 10.800 8.640 N Rnf121 n/a
4 TRCN0000376819 TGGGCAAAGCTGCGGTATTAT pLKO_005 1276 3UTR 100% 15.000 10.500 N Rnf121 n/a
5 TRCN0000376818 GGAGCTAGATGAGGTTGATAT pLKO_005 55 CDS 100% 13.200 9.240 N Rnf121 n/a
6 TRCN0000366929 GTTTACCCTCTTTGGTCTTAA pLKO_005 478 CDS 100% 13.200 9.240 N Rnf121 n/a
7 TRCN0000041121 GCTGCTAGACTGGCTTCGATA pLKO.1 898 CDS 100% 4.950 3.465 N Rnf121 n/a
8 TRCN0000007722 GCTGTCATGTTTACCCTCTTT pLKO.1 470 CDS 100% 4.950 3.465 N RNF121 n/a
9 TRCN0000041120 CCTCATCCTCATTGCTACCTT pLKO.1 169 CDS 100% 3.000 2.100 N Rnf121 n/a
10 TRCN0000375752 AGAAATGTGTGCAGACTATAT pLKO_005 595 CDS 100% 13.200 7.920 N Rnf121 n/a
11 TRCN0000375751 TCTTCTATGGCCTCTACTATG pLKO_005 552 CDS 100% 10.800 6.480 N Rnf121 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.