Transcript: Mouse NM_029245.3

Mus musculus ankyrin repeat domain 53 (Ankrd53), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ankrd53 (75305)
Length:
1737
CDS:
221..1714

Additional Resources:

NCBI RefSeq record:
NM_029245.3
NBCI Gene record:
Ankrd53 (75305)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029245.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241434 CCGAGTTGTGGAGCCATAAAG pLKO_005 426 CDS 100% 13.200 10.560 N Ankrd53 n/a
2 TRCN0000189651 CGGCCCAAGTTATGGAACTAT pLKO.1 1283 CDS 100% 5.625 4.500 N Ankrd53 n/a
3 TRCN0000191767 GTCTTAATAGAGGAGTACAAA pLKO.1 605 CDS 100% 5.625 4.500 N Ankrd53 n/a
4 TRCN0000241436 CCTGGAGGTGACTCGAAATAA pLKO_005 1408 CDS 100% 15.000 10.500 N Ankrd53 n/a
5 TRCN0000241437 CTGCACTTGGTCATCCATAAA pLKO_005 665 CDS 100% 13.200 9.240 N Ankrd53 n/a
6 TRCN0000241435 GTGCACCCAGAACCCTATAAG pLKO_005 1367 CDS 100% 13.200 9.240 N Ankrd53 n/a
7 TRCN0000241438 TCTTAATAGAGGAGTACAAAT pLKO_005 606 CDS 100% 13.200 9.240 N Ankrd53 n/a
8 TRCN0000190216 CCACGGGACATACTCAAAGTA pLKO.1 1565 CDS 100% 5.625 3.938 N Ankrd53 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029245.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.