Transcript: Mouse NM_029292.3

Mus musculus coiled-coil domain containing 7B (Ccdc7b), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-06-17
Taxon:
Mus musculus (mouse)
Gene:
Ccdc7b (75453)
Length:
1052
CDS:
383..934

Additional Resources:

NCBI RefSeq record:
NM_029292.3
NBCI Gene record:
Ccdc7b (75453)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029292.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191792 GCTATGTTACACAAAGCTTTA pLKO.1 431 CDS 100% 10.800 15.120 N Ccdc7b n/a
2 TRCN0000216242 CAGATGGAAACTAATTATGAA pLKO.1 485 CDS 100% 5.625 3.938 N Ccdc7b n/a
3 TRCN0000191658 GATCTCATCTGATCAAAGTAA pLKO.1 886 CDS 100% 5.625 3.938 N Ccdc7b n/a
4 TRCN0000190348 CCAGACAGCTATGTTACACAA pLKO.1 424 CDS 100% 4.950 3.465 N Ccdc7b n/a
5 TRCN0000202245 GACACACAGTTGGGTGAACAA pLKO.1 854 CDS 100% 4.950 3.465 N Ccdc7b n/a
6 TRCN0000217619 GCGAACTAAGAAACCTGGAAA pLKO.1 592 CDS 100% 4.950 3.465 N Ccdc7b n/a
7 TRCN0000191228 CCAGAGTCAGAATAAATCAAA pLKO.1 790 CDS 100% 5.625 3.375 N Ccdc7b n/a
8 TRCN0000200878 GAAGATTCAAAGGATTCCTTA pLKO.1 821 CDS 100% 4.950 2.970 N Ccdc7b n/a
9 TRCN0000201822 GAGAGTAAAGTCTGCAACCAA pLKO.1 565 CDS 100% 3.000 1.800 N Ccdc7b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029292.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.