Transcript: Mouse NM_029296.2

Mus musculus RIKEN cDNA 1700001C19 gene (1700001C19Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
1700001C19Rik (75462)
Length:
1622
CDS:
162..794

Additional Resources:

NCBI RefSeq record:
NM_029296.2
NBCI Gene record:
1700001C19Rik (75462)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192831 GAGAATGCTTTCCAGGATTCA pLKO.1 447 CDS 100% 4.950 6.930 N 1700001C19Rik n/a
2 TRCN0000192372 CCTGGAGAATTGAAAGGGTTT pLKO.1 1016 3UTR 100% 4.050 3.240 N 1700001C19Rik n/a
3 TRCN0000200654 CTTTCCAGGATTCACAGAAAT pLKO.1 454 CDS 100% 13.200 9.240 N 1700001C19Rik n/a
4 TRCN0000191944 GTTTCTACAACTCACAGTATT pLKO.1 646 CDS 100% 13.200 9.240 N 1700001C19Rik n/a
5 TRCN0000190088 GCCTGGAGAATTGAAAGGGTT pLKO.1 1015 3UTR 100% 2.640 1.848 N 1700001C19Rik n/a
6 TRCN0000190056 GCTTTGATGTTCCTCCAGCAA pLKO.1 751 CDS 100% 2.640 1.848 N 1700001C19Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.