Transcript: Mouse NM_029309.2

Mus musculus MORN repeat containing 5 (Morn5), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Morn5 (75495)
Length:
690
CDS:
57..569

Additional Resources:

NCBI RefSeq record:
NM_029309.2
NBCI Gene record:
Morn5 (75495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078928 CCCTACTGACACGAGATACAT pLKO.1 131 CDS 100% 5.625 7.875 N Morn5 n/a
2 TRCN0000078930 CCGGAGGTTCTACACCGAGAT pLKO.1 320 CDS 100% 1.350 1.890 N Morn5 n/a
3 TRCN0000078929 CGGAACCGCTTTCTGAGAAAT pLKO.1 471 CDS 100% 13.200 9.240 N Morn5 n/a
4 TRCN0000078931 GATGACGAACATGAGTGGATT pLKO.1 498 CDS 100% 4.950 3.465 N Morn5 n/a
5 TRCN0000078932 CGCTTTCTGAGAAATGCTGAT pLKO.1 477 CDS 100% 4.050 2.835 N Morn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.