Transcript: Mouse NM_029355.2

Mus musculus prolactin family 7, subfamily b, member 1 (Prl7b1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Prl7b1 (75596)
Length:
925
CDS:
61..816

Additional Resources:

NCBI RefSeq record:
NM_029355.2
NBCI Gene record:
Prl7b1 (75596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109698 GCACTTGAAGTGTCGGTATTT pLKO.1 747 CDS 100% 13.200 18.480 N Prl7b1 n/a
2 TRCN0000109699 AGCACTTGAAGTGTCGGTATT pLKO.1 746 CDS 100% 10.800 15.120 N Prl7b1 n/a
3 TRCN0000109695 CGCAGGATATTTCTATCCAAT pLKO.1 256 CDS 100% 0.495 0.693 N Prl7b1 n/a
4 TRCN0000109697 GCCAATGAAGAATCAAGATTT pLKO.1 661 CDS 100% 13.200 9.240 N Prl7b1 n/a
5 TRCN0000363029 CTATAGAGACACGCAGGATAT pLKO_005 245 CDS 100% 10.800 7.560 N Prl7b1 n/a
6 TRCN0000362961 TAAATTGTCCTATTGCCTATT pLKO_005 693 CDS 100% 10.800 7.560 N Prl7b1 n/a
7 TRCN0000378412 TGGATCAGGTGTTAGCGAAAT pLKO_005 165 CDS 100% 10.800 7.560 N Prl7b1 n/a
8 TRCN0000109696 GCCTATTTGTTGACACAGATA pLKO.1 707 CDS 100% 4.950 3.465 N Prl7b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.